Mature sequence gga-miR-211

Accession numberMIMAT0003368
IDgga-miR-211
Stem-Loop gga-mir-211
Sequence
uucccuuugucauccuaugccu
Get sequence
Deep sequencing780 reads, 5 experiments
Predicted targets

References