Mature sequence hsa-miR-658

Accession numberMIMAT0003336
IDhsa-miR-658
Stem-Loop hsa-mir-658
Sequence
ggcggagggaaguagguccguuggu
Get sequence
Deep sequencing224 reads, 48 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).