Mature sequence hsa-miR-549a-3p

Accession numberMIMAT0003333
IDhsa-miR-549a-3p
Previous IDshsa-miR-549
Stem-Loop hsa-mir-549a
Sequence
ugacaacuauggaugagcucu
Get sequence
Deep sequencing219 reads, 75 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:25822230 "Selective microRNA-Offset RNA expression in human embryonic stem cells" Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O PLoS One. 10:e0116668(2015).