Mature sequence hsa-miR-663a

Accession numberMIMAT0003326
IDhsa-miR-663a
Previous IDshsa-miR-663
Stem-Loop hsa-mir-663a
Sequence
aggcggggcgccgcgggaccgc
Get sequence
Deep sequencing367 reads, 84 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).