Mature sequence hsa-miR-650

Accession numberMIMAT0003320
IDhsa-miR-650
Stem-Loop hsa-mir-650
Sequence
aggaggcagcgcucucaggac
Get sequence
Deep sequencing18 reads, 8 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).