Mature sequence hsa-miR-649

Accession numberMIMAT0003319
IDhsa-miR-649
Stem-Loop hsa-mir-649
Sequence
aaaccuguguuguucaagaguc
Get sequence
Deep sequencing5 reads, 5 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).