Mature sequence hsa-miR-641

Accession numberMIMAT0003311
IDhsa-miR-641
Stem-Loop hsa-mir-641
Sequence
aaagacauaggauagagucaccuc
Get sequence
Deep sequencing6188 reads, 138 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).