Mature sequence hsa-miR-638

Accession numberMIMAT0003308
IDhsa-miR-638
Stem-Loop hsa-mir-638
Sequence
agggaucgcgggcggguggcggccu
Get sequence
Deep sequencing8 reads, 8 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).