Mature sequence hsa-miR-637

Accession numberMIMAT0003307
IDhsa-miR-637
Stem-Loop hsa-mir-637
Sequence
acugggggcuuucgggcucugcgu
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).