Mature sequence hsa-miR-630

Accession numberMIMAT0003299
IDhsa-miR-630
Stem-Loop hsa-mir-630
Sequence
aguauucuguaccagggaaggu
Get sequence
Deep sequencing23770 reads, 21 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).