Mature sequence hsa-miR-622

Accession numberMIMAT0003291
IDhsa-miR-622
Stem-Loop hsa-mir-622
Sequence
acagucugcugagguuggagc
Get sequence
Deep sequencing27 reads, 12 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).