Mature sequence hsa-miR-613

Accession numberMIMAT0003281
IDhsa-miR-613
Stem-Loop hsa-mir-613
Sequence
aggaauguuccuucuuugcc
Get sequence
Deep sequencing86 reads, 7 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).