Mature sequence hsa-miR-608

Accession numberMIMAT0003276
IDhsa-miR-608
Stem-Loop hsa-mir-608
Sequence
aggggugguguugggacagcuccgu
Get sequence
Deep sequencing17 reads, 6 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).