Mature sequence hsa-miR-607

Accession numberMIMAT0003275
IDhsa-miR-607
Stem-Loop hsa-mir-607
Sequence
guucaaauccagaucuauaac
Get sequence
Deep sequencing14 reads, 12 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).