Mature sequence hsa-miR-603

Accession numberMIMAT0003271
IDhsa-miR-603
Stem-Loop hsa-mir-603
Sequence
cacacacugcaauuacuuuugc
Get sequence
Deep sequencing83 reads, 43 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).