Mature sequence hsa-miR-601

Accession numberMIMAT0003269
IDhsa-miR-601
Stem-Loop hsa-mir-601
Sequence
uggucuaggauuguuggaggag
Get sequence
Deep sequencing5 reads, 5 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).