Mature sequence hsa-miR-592

Accession numberMIMAT0003260
IDhsa-miR-592
Stem-Loop hsa-mir-592
Sequence
uugugucaauaugcgaugaugu
Get sequence
Deep sequencing1264 reads, 109 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).