Mature sequence hsa-miR-591

Accession numberMIMAT0003259
IDhsa-miR-591
Stem-Loop hsa-mir-591
Sequence
agaccauggguucucauugu
Get sequence
Deep sequencing9 reads, 7 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).