Mature sequence hsa-miR-588

Accession numberMIMAT0003255
IDhsa-miR-588
Stem-Loop hsa-mir-588
Sequence
uuggccacaauggguuagaac
Get sequence
Deep sequencing86 reads, 29 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).