Mature sequence hsa-miR-587

Accession numberMIMAT0003253
IDhsa-miR-587
Stem-Loop hsa-mir-587
Sequence
uuuccauaggugaugagucac
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).