Mature sequence hsa-miR-586

Accession numberMIMAT0003252
IDhsa-miR-586
Stem-Loop hsa-mir-586
Sequence
uaugcauuguauuuuuaggucc
Get sequence
Deep sequencing36 reads, 13 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).