Mature sequence hsa-miR-578

Accession numberMIMAT0003243
IDhsa-miR-578
Stem-Loop hsa-mir-578
Sequence
cuucuugugcucuaggauugu
Get sequence
Deep sequencing29 reads, 21 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).