Mature sequence hsa-miR-577

Accession numberMIMAT0003242
IDhsa-miR-577
Stem-Loop hsa-mir-577
Sequence
uagauaaaauauugguaccug
Get sequence
Deep sequencing7430 reads, 103 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).