Mature sequence hsa-miR-572

Accession numberMIMAT0003237
IDhsa-miR-572
Stem-Loop hsa-mir-572
Sequence
guccgcucggcgguggccca
Get sequence
Deep sequencing3 reads, 2 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).