Mature sequence hsa-miR-568

Accession numberMIMAT0003232
IDhsa-miR-568
Stem-Loop hsa-mir-568
Sequence
auguauaaauguauacacac
Get sequence
Deep sequencing5 reads, 3 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).