Mature sequence rno-miR-542-3p

Accession numberMIMAT0003179
IDrno-miR-542-3p
Stem-Loop rno-mir-542-1 rno-mir-542-2 rno-mir-542-3
Sequence
ugugacagauugauaacugaaa
Get sequence
Deep sequencing219678 reads, 480 experiments

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).