Mature sequence dre-miR-9-3p

Accession numberMIMAT0003156
IDdre-miR-9-3p
Previous IDsdre-miR-9*
Stem-Loop dre-mir-9-1 dre-mir-9-2 dre-mir-9-3 dre-mir-9-5 dre-mir-9-6
Sequence
uaaagcuagauaaccgaaagu
Get sequence
Deep sequencing93449 reads, 11 experiments
Database links
QuickGO function

References

1
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).