Mature sequence osa-miR535-5p

Accession numberMIMAT0003142
IDosa-miR535-5p
Previous IDsosa-miR535
Stem-Loop osa-MIR535
Sequence
ugacaacgagagagagcacgc
Get sequence
Deep sequencing5823 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).