Mature sequence ppt-miR319c

Accession numberMIMAT0003135
IDppt-miR319c
Stem-Loop ppt-MIR319c
Sequence
cuuggacugaagggagcuccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).