Mature sequence rno-miR-1-3p

Accession numberMIMAT0003125
IDrno-miR-1-3p
Previous IDsrno-miR-1
Stem-Loop rno-mir-1
Sequence
uggaauguaaagaaguguguau
Get sequence
Deep sequencing527035 reads, 404 experiments
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).