Mature sequence tni-miR-210

Accession numberMIMAT0003096
IDtni-miR-210
Stem-Loop tni-mir-210
Sequence
cugugcgugugacagcggcuaa
Get sequence
Deep sequencing reads, experiments

References