Mature sequence fru-miR-29a

Accession numberMIMAT0003053
IDfru-miR-29a
Stem-Loop fru-mir-29a-1 fru-mir-29a-2
Sequence
uagcaccauuugaaaucgguua
Get sequence
Deep sequencing reads, experiments

References