Mature sequence dre-miR-212

Accession numberMIMAT0003049
IDdre-miR-212
Stem-Loop dre-mir-212
Sequence
uaacagucuacagucauggcu
Get sequence
Deep sequencing37 reads, 10 experiments
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).