Mature sequence tni-miR-455

Accession numberMIMAT0003029
IDtni-miR-455
Stem-Loop tni-mir-455
Sequence
uaugugcccuuggacuacaucg
Get sequence
Deep sequencing reads, experiments

References