Mature sequence fru-miR-455

Accession numberMIMAT0003028
IDfru-miR-455
Stem-Loop fru-mir-455
Sequence
uaugugcccuuggacuacaucg
Get sequence
Deep sequencing reads, experiments

References