Mature sequence tni-miR-460

Accession numberMIMAT0002998
IDtni-miR-460
Stem-Loop tni-mir-460
Sequence
cacagcgcauacaauguggaug
Get sequence
Deep sequencing reads, experiments

References