Mature sequence fru-miR-460

Accession numberMIMAT0002997
IDfru-miR-460
Stem-Loop fru-mir-460
Sequence
cacagcgcauacaauguggaug
Get sequence
Deep sequencing reads, experiments

References