Mature sequence tni-miR-365

Accession numberMIMAT0002968
IDtni-miR-365
Stem-Loop tni-mir-365
Sequence
uaaugccccuaaaaauccuuau
Get sequence
Deep sequencing reads, experiments

References