Mature sequence fru-miR-365

Accession numberMIMAT0002967
IDfru-miR-365
Stem-Loop fru-mir-365
Sequence
uaaugccccuaaaaauccuuau
Get sequence
Deep sequencing reads, experiments

References