Mature sequence tni-miR-199

Accession numberMIMAT0002960
IDtni-miR-199
Stem-Loop tni-mir-199-3 tni-mir-199-2 tni-mir-199-1
Sequence
cccaguguucagacuaccuguuc
Get sequence
Deep sequencing reads, experiments

References