Mature sequence tni-miR-192

Accession numberMIMAT0002942
IDtni-miR-192
Stem-Loop tni-mir-192
Sequence
augaccuaugaauugacagcc
Get sequence
Deep sequencing reads, experiments

References