Mature sequence fru-miR-192

Accession numberMIMAT0002941
IDfru-miR-192
Stem-Loop fru-mir-192
Sequence
augaccuaugaauugacagcc
Get sequence
Deep sequencing reads, experiments

References