Mature sequence tni-miR-184

Accession numberMIMAT0002927
IDtni-miR-184
Stem-Loop tni-mir-184
Sequence
uggacggagaacugauaaggg
Get sequence
Deep sequencing reads, experiments

References