Mature sequence tni-miR-19a

Accession numberMIMAT0002921
IDtni-miR-19a
Stem-Loop tni-mir-19a
Sequence
ugugcaaaucuaugcaaaacuga
Get sequence
Deep sequencing reads, experiments

References