Mature sequence tni-miR-17

Accession numberMIMAT0002917
IDtni-miR-17
Stem-Loop tni-mir-17-1 tni-mir-17-2
Sequence
caaagugcuuacagugcaggua
Get sequence
Deep sequencing reads, experiments

References