Mature sequence tni-miR-9

Accession numberMIMAT0002911
IDtni-miR-9
Stem-Loop tni-mir-9-1 tni-mir-9-2 tni-mir-9-4 tni-mir-9-3
Sequence
ucuuugguuaucuagcuguauga
Get sequence
Deep sequencing reads, experiments

References