Mature sequence fru-miR-9

Accession numberMIMAT0002910
IDfru-miR-9
Stem-Loop fru-mir-9-1 fru-mir-9-2 fru-mir-9-4 fru-mir-9-3
Sequence
ucuuugguuaucuagcuguauga
Get sequence
Deep sequencing reads, experiments

References