Mature sequence osa-miR530-3p

Accession numberMIMAT0002886
IDosa-miR530-3p
Previous IDsosa-miR530
Stem-Loop osa-MIR530
Sequence
aggugcagaggcagaugcaac
Get sequence
Deep sequencing5 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:16126864 "Loss of function of OsDCL1 affects microRNA accumulation and causes developmental defects in rice" Liu B, Li P, Li X, Liu C, Cao S, Chu C, Cao X Plant Physiol. 139:296-305(2005).
2
PMID:18363789 "Stress-responsive microRNAs in Populus" Lu S, Sun YH, Chiang VL Plant J. 55:131-151(2008).