Mature sequence hsa-miR-507

Accession numberMIMAT0002879
IDhsa-miR-507
Stem-Loop hsa-mir-507
Sequence
uuuugcaccuuuuggagugaa
Get sequence
Deep sequencing508 reads, 27 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).