Mature sequence hsa-miR-506-3p

Accession numberMIMAT0002878
IDhsa-miR-506-3p
Previous IDshsa-miR-506
Stem-Loop hsa-mir-506
Sequence
uaaggcacccuucugaguaga
Get sequence
Deep sequencing12894 reads, 47 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).